m ay 3 (Addgene inc)
Addgene inc is a verified supplier 
91
Structured Review
Addgene inc
m ay 3
M Ay 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/m+ay+3/pLKO-puro+human+lipin+1-1+shRNA+(Plasmid+%2332019)/pm31043460-89-37-106
Average 91 stars, based on 3 article reviews
M Ay 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/m+ay+3/pLKO-puro+human+lipin+1-1+shRNA+(Plasmid+%2332019)/pm31043460-89-37-106
Average 91 stars, based on 3 article reviews
m ay 3 - by Bioz Stars,
2026-10
91/100 stars
Images
Related Articles
Sequencing:Article Title: Identification of MRP4/ABCC4 as a Target for Reducing the Proliferation of Pancreatic Ductal Adenocarcinoma Cells by Modulating the cAMP Efflux. Article Snippet: Oligonucleotides were cloned into the pSUPER.retro.puro vector (OligoEngine); their correct orientation after cloning was confirmed by DNA sequencing using the following primer: 5 ́-GGAAGCCTTGGCTTTTG-3 ́ (Macrogen). .. MRP4-shRNA oligonucleotides contained a MRP4 mRNA specific region, a hairpin loop region (bold), and a linker sequence for subcloning into the pSUPER vector (italic): MRP4-shRNA1 sequence (5 ́-3 ́) sense:GATCCCCCAGTGTTCTTACACTTCCTTTCAAGAGAAGGAAGTGTAAGAACACT GTTTTTA antisense:AGCTTAAAAACAGTGTTCTTACACTTCCTTCTCTTGAAAGGAAGTGTAAGAA CACTGGGG at A SPE T Journals on Subcloning:Article Title: Identification of MRP4/ABCC4 as a Target for Reducing the Proliferation of Pancreatic Ductal Adenocarcinoma Cells by Modulating the cAMP Efflux. Article Snippet: Oligonucleotides were cloned into the pSUPER.retro.puro vector (OligoEngine); their correct orientation after cloning was confirmed by DNA sequencing using the following primer: 5 ́-GGAAGCCTTGGCTTTTG-3 ́ (Macrogen). .. MRP4-shRNA oligonucleotides contained a MRP4 mRNA specific region, a hairpin loop region (bold), and a linker sequence for subcloning into the pSUPER vector (italic): MRP4-shRNA1 sequence (5 ́-3 ́) sense:GATCCCCCAGTGTTCTTACACTTCCTTTCAAGAGAAGGAAGTGTAAGAACACT GTTTTTA antisense:AGCTTAAAAACAGTGTTCTTACACTTCCTTCTCTTGAAAGGAAGTGTAAGAA CACTGGGG at A SPE T Journals on Plasmid Preparation:Article Title: Identification of MRP4/ABCC4 as a Target for Reducing the Proliferation of Pancreatic Ductal Adenocarcinoma Cells by Modulating the cAMP Efflux. Article Snippet: Oligonucleotides were cloned into the pSUPER.retro.puro vector (OligoEngine); their correct orientation after cloning was confirmed by DNA sequencing using the following primer: 5 ́-GGAAGCCTTGGCTTTTG-3 ́ (Macrogen). .. MRP4-shRNA oligonucleotides contained a MRP4 mRNA specific region, a hairpin loop region (bold), and a linker sequence for subcloning into the pSUPER vector (italic): MRP4-shRNA1 sequence (5 ́-3 ́) sense:GATCCCCCAGTGTTCTTACACTTCCTTTCAAGAGAAGGAAGTGTAAGAACACT GTTTTTA antisense:AGCTTAAAAACAGTGTTCTTACACTTCCTTCTCTTGAAAGGAAGTGTAAGAA CACTGGGG at A SPE T Journals on Expressing:Article Title: Identification of MRP4/ABCC4 as a Target for Reducing the Proliferation of Pancreatic Ductal Adenocarcinoma Cells by Modulating the cAMP Efflux. Article Snippet: Oligonucleotides were cloned into the pSUPER.retro.puro vector (OligoEngine); their correct orientation after cloning was confirmed by DNA sequencing using the following primer: 5 ́-GGAAGCCTTGGCTTTTG-3 ́ (Macrogen). .. MRP4-shRNA oligonucleotides contained a MRP4 mRNA specific region, a hairpin loop region (bold), and a linker sequence for subcloning into the pSUPER vector (italic): MRP4-shRNA1 sequence (5 ́-3 ́) sense:GATCCCCCAGTGTTCTTACACTTCCTTTCAAGAGAAGGAAGTGTAAGAACACT GTTTTTA antisense:AGCTTAAAAACAGTGTTCTTACACTTCCTTCTCTTGAAAGGAAGTGTAAGAA CACTGGGG at A SPE T Journals on shRNA:Article Title: Identification of MRP4/ABCC4 as a Target for Reducing the Proliferation of Pancreatic Ductal Adenocarcinoma Cells by Modulating the cAMP Efflux. Article Snippet: Oligonucleotides were cloned into the pSUPER.retro.puro vector (OligoEngine); their correct orientation after cloning was confirmed by DNA sequencing using the following primer: 5 ́-GGAAGCCTTGGCTTTTG-3 ́ (Macrogen). .. MRP4-shRNA oligonucleotides contained a MRP4 mRNA specific region, a hairpin loop region (bold), and a linker sequence for subcloning into the pSUPER vector (italic): MRP4-shRNA1 sequence (5 ́-3 ́) sense:GATCCCCCAGTGTTCTTACACTTCCTTTCAAGAGAAGGAAGTGTAAGAACACT GTTTTTA antisense:AGCTTAAAAACAGTGTTCTTACACTTCCTTCTCTTGAAAGGAAGTGTAAGAA CACTGGGG at A SPE T Journals on Generated:Article Title: Identification of MRP4/ABCC4 as a Target for Reducing the Proliferation of Pancreatic Ductal Adenocarcinoma Cells by Modulating the cAMP Efflux. Article Snippet: Oligonucleotides were cloned into the pSUPER.retro.puro vector (OligoEngine); their correct orientation after cloning was confirmed by DNA sequencing using the following primer: 5 ́-GGAAGCCTTGGCTTTTG-3 ́ (Macrogen). .. MRP4-shRNA oligonucleotides contained a MRP4 mRNA specific region, a hairpin loop region (bold), and a linker sequence for subcloning into the pSUPER vector (italic): MRP4-shRNA1 sequence (5 ́-3 ́) sense:GATCCCCCAGTGTTCTTACACTTCCTTTCAAGAGAAGGAAGTGTAAGAACACT GTTTTTA antisense:AGCTTAAAAACAGTGTTCTTACACTTCCTTCTCTTGAAAGGAAGTGTAAGAA CACTGGGG at A SPE T Journals on |